Adapter Trimming - Usage Guide

Overview

Sequencing adapters appear in reads only when the insert is shorter than the read length (read-through), so adapter content is a direct readout of the insert-size distribution. Adapter is foreign sequence with genuine base quality, so aligners may mis-anchor on it -- which is why adapter trimming is the one near-universal preprocessing step (quality trimming usually is not, because aligners soft-clip). Cutadapt gives precise, error-tolerant control; Trimmomatic adds palindrome mode for paired read-through; fastp trims paired adapters from the read overlap with no adapter sequence needed.

Prerequisites

# Cutadapt
conda install -c bioconda cutadapt
# Trimmomatic
conda install -c bioconda trimmomatic
# fastp (all-in-one alternative)
conda install -c bioconda fastp

Quick Start

Tell your AI agent what you want to do: - "Remove TruSeq adapters from my paired-end reads" - "Trim small-RNA adapters and keep only 18-30 nt inserts" - "My FastQC adapter-content curve climbs toward the 3' end, fix it" - "Remove amplicon primers from my reads"

Example Prompts

Standard trimming

"Remove TruSeq adapters from my paired-end FASTQ files and discard reads shorter than 20 bp"

"Trim Nextera adapters from my reads with Cutadapt"

Short-insert / small-RNA

"Trim the small-RNA 3' adapter, gate inserts to 18-30 nt, and drop reads with no adapter"

"My inserts are short (cfDNA) so most reads read through; trim the adapter from both mates"

Read-through and troubleshooting

"Detect paired read-through without knowing the adapter sequence"

"FastQC still shows adapter after trimming, raise the error tolerance and use the shared stem"

What the Agent Will Do

Identify the adapter from the kit, FastQC overrepresented sequences, or read-through detection
Choose the tool (cutadapt for precision/small-RNA/amplicon, fastp for bulk PE overlap, Trimmomatic for palindrome)
Trim 3' adapter from both mates together, keeping pairs synchronized
Apply a minimum-length filter so adapter dimers (which collapse to ~0 bp) are dropped
Verify removal with post-trim FastQC

Common Adapter Sequences

Library	Adapter
Illumina TruSeq (shared stem)	`AGATCGGAAGAGC`
Nextera / Tn5	`CTGTCTCTTATACACATCT`
Small RNA	`TGGAATTCTCGGGTGCCAAGG`

Tips

The adapter-content curve in FastQC is an insert-size readout; a climb toward the 3' end means short inserts reading through.
Trim adapter even when skipping quality trimming -- soft-clipping aligners handle low-quality tails but mis-anchor on adapter.
Small-RNA inverts the rule: use --discard-untrimmed and a tight length gate, because a no-adapter read is junk.
Always pair adapter trimming with a minimum-length filter so adapter dimers are removed.
Trimmomatic steps run in command-line order; put ILLUMINACLIP first and MINLEN last.
Trimmomatic palindrome mode drops the redundant R2 by default (keepBothReads False); add keepBothReads if a downstream tool needs both mates.
On 2-color instruments, a high-quality poly-G tail is not adapter; use a poly-G-aware trim (cutadapt --nextseq-trim or fastp).

Resources

read-qc/quality-reports - Read the adapter-content panel that triggers trimming read-qc/quality-filtering - Quality and length filtering after adapter removal read-qc/fastp-workflow - All-in-one adapter + quality trim with auto poly-G read-qc/contamination-screening - k-mer removal of PhiX/vector/contaminant sequence small-rna-seq/smrna-preprocessing - Full small-RNA adapter + length workflow